Sort by:
Publication Type:
Open access:
Publication Date:
Periodicals:
Search results
Online since: June 2010
Authors: Cheng Jia Shang, Cheng Liang Miao, Guo Dong Zhang
Therein, the design of reductions and pass
intervals are based on actual hot strip rolling of industrial pipeline steel.
Strain-stress data were recorded for all simulated tests, and mean flow stress (MFS) values were caculated [6] in the analysis for process 2.
According to DRX kinetic equations deduced in the last section, the critical strains for the onset of DRX were calculated in the case of 25% reduction at 960°C and strain rate of 3s-1, 0.06Nb and 0.1Nb steel need an accumulation strain of 0.34 and 0.45 respectviely.
However, by optimizing reduction rate (decreasing) at higher temperture rolling passes, as the relativey lower MFS and accumulation strain, the DRX can be restrained, and the highest final MFS of higher Nb content steel can be achived, as a consequence, homogeneous grain structure and high Sv will be obtained.
However, through reducing strain rate at high temperature and usage of large reduction rate in the low temperature range during strip rolling, the DRX for high Nb steel has to be restrained, and higher strain accumulation will be acquired.
Strain-stress data were recorded for all simulated tests, and mean flow stress (MFS) values were caculated [6] in the analysis for process 2.
According to DRX kinetic equations deduced in the last section, the critical strains for the onset of DRX were calculated in the case of 25% reduction at 960°C and strain rate of 3s-1, 0.06Nb and 0.1Nb steel need an accumulation strain of 0.34 and 0.45 respectviely.
However, by optimizing reduction rate (decreasing) at higher temperture rolling passes, as the relativey lower MFS and accumulation strain, the DRX can be restrained, and the highest final MFS of higher Nb content steel can be achived, as a consequence, homogeneous grain structure and high Sv will be obtained.
However, through reducing strain rate at high temperature and usage of large reduction rate in the low temperature range during strip rolling, the DRX for high Nb steel has to be restrained, and higher strain accumulation will be acquired.
Online since: January 2012
Authors: Li Mei Bai, Bo Liu, Xiao Liang Zhang, Yu Xin Ma, Yu Hao
Through the data access and the exploration of the test to confirm the roasting time, the roasting temperature, the dosage of deoxidizer as the main factors of magnetizing roasting; Grinding fineness, magnetic field intensity as the main factors of low intensity magnetic separation[8-9].
Fig. 2 The influence of coal content on the grade and recovery Fig. 1 Flow sheet of magnetic roasting- magnetic separation According to Fig.2, under the temperature of 800℃, with the increasing dosage of the pulverized coal, the magnetic concentrate’s grade of the baked ore rises constantly after the first reduction. in the condition of the mass percent of the coal is 9%, the Minimum of the total iron’s grade is 58.17%, in the condition of the pulverized coal’s content is 12%, it reaches to the maximum that is 63.42%.With the increasing dosage of the pulverized coal, the magnetic concentrate’s recovery of the baked ore also rises constantly after the first reduction, in the condition of the mass percent of coal is 9%, the recovery reaches minimum and then rises constantly in the condition of the increasing dosage of the pulverized coal.
But the reduction reaction is very slow, After 75 min’s reaction , the hematite can’t totally transformed into magnetite; and the Fe3O4 which formed at low temperature has a weakly magnetic, so when the temperature is lower than 800℃, the recovery can increase as the increasing of the temperature, At last , 800℃ is chosen as the best temperature.
Testing Investigation on the Reduction/Magnetic Separation of Oxide Ore from Bayan Obo[J], Journal Of Northeastern University(Natural Science) , Vol.31(2010),P.886-889
Fig. 2 The influence of coal content on the grade and recovery Fig. 1 Flow sheet of magnetic roasting- magnetic separation According to Fig.2, under the temperature of 800℃, with the increasing dosage of the pulverized coal, the magnetic concentrate’s grade of the baked ore rises constantly after the first reduction. in the condition of the mass percent of the coal is 9%, the Minimum of the total iron’s grade is 58.17%, in the condition of the pulverized coal’s content is 12%, it reaches to the maximum that is 63.42%.With the increasing dosage of the pulverized coal, the magnetic concentrate’s recovery of the baked ore also rises constantly after the first reduction, in the condition of the mass percent of coal is 9%, the recovery reaches minimum and then rises constantly in the condition of the increasing dosage of the pulverized coal.
But the reduction reaction is very slow, After 75 min’s reaction , the hematite can’t totally transformed into magnetite; and the Fe3O4 which formed at low temperature has a weakly magnetic, so when the temperature is lower than 800℃, the recovery can increase as the increasing of the temperature, At last , 800℃ is chosen as the best temperature.
Testing Investigation on the Reduction/Magnetic Separation of Oxide Ore from Bayan Obo[J], Journal Of Northeastern University(Natural Science) , Vol.31(2010),P.886-889
Online since: March 2025
Authors: Takehiko Makino, Kazuhiko Kitamura, Masanori Nawa
Thus, in most machines some sensors will be installed to use big data for efficient manufactures as well as maintain itself.
Finally, the reduction in thickness R is calculated by the following equation (1), where R is the reduction in thickness, Do is the outside diameter of the initial workpiece, Di is the inside diameter of the initial workpiece, do is the outside diameter of the ironed workpiece, and di is the inside diameter of the ironed workpiece.
Fig. 5 Observation of ball surface after ironing of stainless-steel tube Reduction in load.
The machine dimples never indicate the load reduction.
Finally, the reduction in thickness R is calculated by the following equation (1), where R is the reduction in thickness, Do is the outside diameter of the initial workpiece, Di is the inside diameter of the initial workpiece, do is the outside diameter of the ironed workpiece, and di is the inside diameter of the ironed workpiece.
Fig. 5 Observation of ball surface after ironing of stainless-steel tube Reduction in load.
The machine dimples never indicate the load reduction.
Online since: June 2015
Authors: Mietek Bakowski, Jang Kwon Lim, Wlodek Kaplan, Sergey A. Reshanov, Adolf Schöner, A. Zhang, Tomas Hjort, Hans Peter Nee
However, the improvement of I-V characteristics and reduction of the on-resistance, Ron, was found necessary.
It is clearly demonstrated that the Schottky contact is effectively shielded by the high barrier introduced by the buried p-type regions, which results in the reduction of the electric field and reduced Schottky barrier lowering [5].
The reduction of the maximum blocking voltage between 25 oC and 350 oC reaches 300 V when the channel layer thickness is increased to 2.3 µm.
As shown in Fig. 8, the reduction of the maximum blocking voltage between 25 oC and 350 oC is approximately 800 V when the p-grid doping is 1.2×1017 cm-3.
The measurement data from a set of experimental samples with low p+ grid doping are also shown.
It is clearly demonstrated that the Schottky contact is effectively shielded by the high barrier introduced by the buried p-type regions, which results in the reduction of the electric field and reduced Schottky barrier lowering [5].
The reduction of the maximum blocking voltage between 25 oC and 350 oC reaches 300 V when the channel layer thickness is increased to 2.3 µm.
As shown in Fig. 8, the reduction of the maximum blocking voltage between 25 oC and 350 oC is approximately 800 V when the p-grid doping is 1.2×1017 cm-3.
The measurement data from a set of experimental samples with low p+ grid doping are also shown.
Online since: August 2017
Authors: Zhen Yuan Nie, Jin Lan Xia, Yun Yang, Ya Long Ma, Hong Chang Liu, Li Zhu Liu, Xuan Pan, Peng Yuan
%d
1
gi|917845999
hypothetical protein
Sulfolobus islandicus
163129/5.77
97.43
2
gi|332694348
conserved hypothetical protein
Acidianus hospitalis
48665.4/7.03
97.59
3
gi|503541050
D-galactarate dehydratase
Acidianus hospitalis
42119.9/5.4
100
4
gi|503541050
D-galactarate dehydratase
Acidianus hospitalis
42119.9/5.4
100
5
gi|612167172
glutaredoxin
Acidianus copahuensis
25841.9/4.66
99.99
6
gi|332694619
superoxide dismutase
Acidianus hospitalis
24296.3/6.71
100
7
gi|332694619
superoxide dismutase
Acidianus hospitalis
24296.3/6.71
100
8
gi|612170351
superoxide dismutase
Acidianus copahuensis
24164.1/6.44
100
9
gi|332694619
superoxide dismutase
Acidianus hospitalis
24296.3/6.71
100
10
gi|503541427
ATPase
Acidianus hospitalis
36612/8.57
76.55
11
gi|612170409
sulfur reduction protein DsrE
Acidianus copahuensis
15340.4/4.72
100
12
gi|612170409
sulfur reduction protein DsrE
Acidianus copahuensis
15340.4/4.72
100
13
gi|756978656
ATPase
Desulfurococcus amylolyticus
68444/8.46
88.62
14
gi|332694027
/˚C Amplicon length /bp 1 B6F84_04620 Hypothetical protein F: CTCCTTTCAGCAGGGAAAAA R: AGAGGCCTTAGCATATGGAGAA 52 204 3 B6F84_06985 Hypothetical protein F: GAAGCTCGAAAGGTCGGAAT R: TGCAGGAGCAGTTGCATTAG 52 134 5 B6F84_08030 Glutaredoxin F: TTGGTAGCCTATGAAGCGTGT R: GGCACTGGCTATTACTTGATACTT 52 111 6 B6F84_09650 Phosphoribosylformyl- glycinamidine synthase II F: GCAGCAGTTGGTGTGGTAAA R: GCACCAATTTCGTCTTCTCC 52 155 10 B6F84_06265 Replication factor C large subunit F: AAGCAAAGAATGCCGTGACT R: TTGCTACTCCTGGACCCATT 52 213 11 B6F84_12565 Sulfur reduction protein DsrE F: TGTGGCACATATCCTTTAGGC R: GGCTTCAATATCGGCTTCAA 52 197 17 B6F84_03615 Serine protease F: AGCTAGATTGCTGGCCTGTC R: ATCGGGAGCTAAAGGAGCTG 52 176 18 B6F84_04980 Gluconolaconase F:CAGTTTCTAATGGTTTAGGATGGAA R: CGGTCATTCCGTCAGGATTA 52 171 26 B6F84_05265 Aldehyde oxidase F: AGATTGAGACTAGAAAAGAGCATC R: TGAGCTAGCAATAAATGCAGGA 52 173 Reference genes gi|145688429 16S rRNA F: AGAGGGCTTTTCCCTACTGC R: GCCCCTACTCTGGGAGTACC 52 232 Note: (a) IDs
B6F84_08030, B6F84_12565 and B6F84_04980) encoding glutaredoxin, sulfur reduction protein DsrE and gluconolaconase were also found in other species (Tables 2-3), indicating that these genes might have significant role during activation/biooxidation of S0.
RT-qPCR expression data for selected genes A. manzaensis.
/˚C Amplicon length /bp 1 B6F84_04620 Hypothetical protein F: CTCCTTTCAGCAGGGAAAAA R: AGAGGCCTTAGCATATGGAGAA 52 204 3 B6F84_06985 Hypothetical protein F: GAAGCTCGAAAGGTCGGAAT R: TGCAGGAGCAGTTGCATTAG 52 134 5 B6F84_08030 Glutaredoxin F: TTGGTAGCCTATGAAGCGTGT R: GGCACTGGCTATTACTTGATACTT 52 111 6 B6F84_09650 Phosphoribosylformyl- glycinamidine synthase II F: GCAGCAGTTGGTGTGGTAAA R: GCACCAATTTCGTCTTCTCC 52 155 10 B6F84_06265 Replication factor C large subunit F: AAGCAAAGAATGCCGTGACT R: TTGCTACTCCTGGACCCATT 52 213 11 B6F84_12565 Sulfur reduction protein DsrE F: TGTGGCACATATCCTTTAGGC R: GGCTTCAATATCGGCTTCAA 52 197 17 B6F84_03615 Serine protease F: AGCTAGATTGCTGGCCTGTC R: ATCGGGAGCTAAAGGAGCTG 52 176 18 B6F84_04980 Gluconolaconase F:CAGTTTCTAATGGTTTAGGATGGAA R: CGGTCATTCCGTCAGGATTA 52 171 26 B6F84_05265 Aldehyde oxidase F: AGATTGAGACTAGAAAAGAGCATC R: TGAGCTAGCAATAAATGCAGGA 52 173 Reference genes gi|145688429 16S rRNA F: AGAGGGCTTTTCCCTACTGC R: GCCCCTACTCTGGGAGTACC 52 232 Note: (a) IDs
B6F84_08030, B6F84_12565 and B6F84_04980) encoding glutaredoxin, sulfur reduction protein DsrE and gluconolaconase were also found in other species (Tables 2-3), indicating that these genes might have significant role during activation/biooxidation of S0.
RT-qPCR expression data for selected genes A. manzaensis.
Online since: February 2015
Authors: Ill Soo Kim, Min Ho Park, Jong Pyo Lee, Qian Qian Wu, Cheol Kyun Park
The reduction of variable greatly reduces the difficulty of programming and shortens the calculating time.
As mentioned before, the most prominent advantages of the algorithm were reduction of variables in the Hough transform and algorithm simplification in feature points detection.
The reduction of computing time is good for real-time welding and the error which is caused by the time delay of robot arm movement.
Moreover, the less memory cost results in the production cost reduction that makes it capable for industrial application.
The application of modified Hough algorithm was also conductive to the later algorithms design since it helps decreasing the calculation data in the later steps from millions to at most hundreds.
As mentioned before, the most prominent advantages of the algorithm were reduction of variables in the Hough transform and algorithm simplification in feature points detection.
The reduction of computing time is good for real-time welding and the error which is caused by the time delay of robot arm movement.
Moreover, the less memory cost results in the production cost reduction that makes it capable for industrial application.
The application of modified Hough algorithm was also conductive to the later algorithms design since it helps decreasing the calculation data in the later steps from millions to at most hundreds.
Online since: September 2014
Authors: Francesco Villa, Sergio Baragetti, Riccardo Gerosa
The first consideration to be highlighted from the data of Fig. 1 is that the application of a PVD coating on a 7075-T6 substrate in a high applied stresses region of the S-N curve (i.e.
When considering the effects of the aggressive environment, the most evident result is a strong reduction of the fatigue life of the uncoated 7075-T6 material in methanol: the limiting stress is 199 MPa for the rougher specimens and 195 MPa for the diamond polished samples.
From the testing and the SEM investigation, it can be concluded that: · A certain reduction of the fatigue strength at 2∙105 is found in air, caused by the coating process, especially for the diamond polished specimens (-15% on the limiting stress)
· A dramatic reduction of the limiting stress is found in the uncoated specimens exposed to methanol, in terms of -16% for the 1200 grit paper surface finishing and -29% for the diamond polished specimen.
· The beneficial effects of the DLC layer in aggressive environment disappear for a 1200 grit paper treated surface, showing a -20 % drop in fatigue strength from the DLC coated specimen in air, comparable to the reduction experienced by the uncoated specimens in methanol (-16%).
When considering the effects of the aggressive environment, the most evident result is a strong reduction of the fatigue life of the uncoated 7075-T6 material in methanol: the limiting stress is 199 MPa for the rougher specimens and 195 MPa for the diamond polished samples.
From the testing and the SEM investigation, it can be concluded that: · A certain reduction of the fatigue strength at 2∙105 is found in air, caused by the coating process, especially for the diamond polished specimens (-15% on the limiting stress)
· A dramatic reduction of the limiting stress is found in the uncoated specimens exposed to methanol, in terms of -16% for the 1200 grit paper surface finishing and -29% for the diamond polished specimen.
· The beneficial effects of the DLC layer in aggressive environment disappear for a 1200 grit paper treated surface, showing a -20 % drop in fatigue strength from the DLC coated specimen in air, comparable to the reduction experienced by the uncoated specimens in methanol (-16%).
Online since: October 2012
Authors: Ting Wang, Huai Bao Ma, Kun Peng Li, Shu Kui Chen, Jun Hua Zhang
General situation of Zhenshui
Xiaolangdi Reservoir is a comprehensive utilization project and its development mission was definitely oriented to flood control (including ice prevention) and sedimentation reduction, and balanced water supply, irrigation and hydropower generation.
Field observation data show that: there is little incoming water and sediment in Zhenshui, and basically there is no sediment.
When water level declines, if water level difference is not enough to influence the stability of sand bar or the sand bar is not completely broken, then the isolated water body will come into being, the storage capacity of tributary will not be effectively used, and the efficiency of sedimentation reduction and even flood control will be affected.
According to present research requirement, based on terrain formed by the test of operational mode one of Xiaolangdi Reservoir for flood control and sedimentation reduction during later sediment retaining period [3], the sand bar at estuary of Zhenshui is modified little and then is adopted as the initial terrain of this test.
P., and Wang Y.: Report on model test of the first operational mode of Xiaolangdi Reservoir for flood control and sedimentation reduction during later sediment retaining period (Yellow River Institute of Hydraulic Research, YRCC, China 2010, In Chinese ).
Field observation data show that: there is little incoming water and sediment in Zhenshui, and basically there is no sediment.
When water level declines, if water level difference is not enough to influence the stability of sand bar or the sand bar is not completely broken, then the isolated water body will come into being, the storage capacity of tributary will not be effectively used, and the efficiency of sedimentation reduction and even flood control will be affected.
According to present research requirement, based on terrain formed by the test of operational mode one of Xiaolangdi Reservoir for flood control and sedimentation reduction during later sediment retaining period [3], the sand bar at estuary of Zhenshui is modified little and then is adopted as the initial terrain of this test.
P., and Wang Y.: Report on model test of the first operational mode of Xiaolangdi Reservoir for flood control and sedimentation reduction during later sediment retaining period (Yellow River Institute of Hydraulic Research, YRCC, China 2010, In Chinese ).
Online since: October 2006
Authors: Sang Ll Lee, Joon Hyun Lee, Yun Seok Shin, Young Ho Kim, Jin Kyu Lee, Jun Young Park
The nondestructive
tester is composed of pulse/receiver device, oscilloscope and computer for the exact measurement and
the data analysis of ultrasonic wave.
The MoSi2 material represented a longitudinal wave velocity of about 6900 m/s at the thermal shock of 80 cycles after its rapid reduction beyond the thermal shock of 60 cycles (373 K).
The increase of thermal shock temperature also decreased the number of repeated cycle for a great reduction of material strength
(3) The velocity of longitudinal wave for MoSi2 materials greatly decreased due to the thermal aging after the steady reduction at the beginning of the thermal shock cycle, regardless of thermal shock temperatures.
The MoSi2 material represented the drastic reduction of longitudinal wave velocity at the thermal shock of 40 cycles under the temperature of 423 K
The MoSi2 material represented a longitudinal wave velocity of about 6900 m/s at the thermal shock of 80 cycles after its rapid reduction beyond the thermal shock of 60 cycles (373 K).
The increase of thermal shock temperature also decreased the number of repeated cycle for a great reduction of material strength
(3) The velocity of longitudinal wave for MoSi2 materials greatly decreased due to the thermal aging after the steady reduction at the beginning of the thermal shock cycle, regardless of thermal shock temperatures.
The MoSi2 material represented the drastic reduction of longitudinal wave velocity at the thermal shock of 40 cycles under the temperature of 423 K
Online since: June 2021
Authors: Zhang Feng Wang, Meng Jun Wang, Chi Xiang Ou, Bai Chen Chen, Gang Xian Fan
The tensile properties were tested in the universal tensile tester with the special tooling chuck at the stretching rate of 0.5mm/min, and each tensile test data were tested in three times.
The variation of ultimate tensile strength (UTS), yield strength (YS) and elongation, reduction of area are shown in Fig. 5(b) and (c).
In the upper rim, the values of UTS, YS and elongation, reduction of area are equal to 282.4MPa, 185.1MPa and 14.3%, 5.6%, respectively, indicating the best mechanical properties.
After hot spinning, the elongation and area reduction of the rim are as high as 18.9% and 19.7%.
The tensile strength and yield strength of the lower rim are slightly lower than the upper rim, but its elongation and reduction of area are slightly improved.
The variation of ultimate tensile strength (UTS), yield strength (YS) and elongation, reduction of area are shown in Fig. 5(b) and (c).
In the upper rim, the values of UTS, YS and elongation, reduction of area are equal to 282.4MPa, 185.1MPa and 14.3%, 5.6%, respectively, indicating the best mechanical properties.
After hot spinning, the elongation and area reduction of the rim are as high as 18.9% and 19.7%.
The tensile strength and yield strength of the lower rim are slightly lower than the upper rim, but its elongation and reduction of area are slightly improved.