Search results

HEAT TREATMENT IS BY AND LARGE USED FOR ENHANCING PROPERTIES OF THE TOOL STEELS.
The technique of cryogenic treatment is an inexpensive method that improves the physical and mechanical properties of tools.
Cryogenic treatment is the process of cooling a material to extremely low temperatures to generate enhanced mechanical and physical properties.
They studied mechanical properties, wear behavior and microstructure of AISI M2.
In this investigation, which is carried out for 3 factors each factor at 3 levels, an L9 (34) orthogonal array is chosen for conducting the experiments.

One key factor that regulates intercellular signaling and cell differentiation is the extracellular matrix microenvironment.
One potential application for the HAp matrix is to permanently stabilize an implant, such as bone, by coating the matrix with cells or growth factors to promote growth and healing [1].
Thus, bone tissue engineering may yield alternative solutions with better mechanical properties and biologic activities than those used currently.
Asterisks and arrows indicate macro- and micro pores. * * * * Table 1 Primer list Primer Sequence (5'-3') oligo (dT) CTGATCTAGAGGTACCGGATCCT20 GAPDH forward ACCACAGTCCATGCCATCAC GAPDH reverse TCCACCACCCTGTTGCTGTA Col I forward GAACTTGGGGCAAGACAGTCA Col I reverse GTCACGTTCAGTTGGTCAA Col X forward CAGTGCTAACCAGGGGGTAA Col X reverse ATGGGAGCCACTAGGAATCCTGAGA OC forward ATGAGGACCCTCTCTCTGCTC OC reverse GTGGTGCCATAGATGCGCTTG properties of the AFS and examined how the AFS microenvironment affects proliferation and differentiation of bone marrow-derived cells into osteoblasts and chondrocytes.
The matrix microenvironment is a key factor in regulation of intercellular signaling and cell differentiation [6].

Energy consumption associated with rock destruction is a critical measure of drilling efficiency, directly affecting operational costs, tool durability, and overall process effectiveness.
Wear, primarily caused by abrasive and erosive interactions with rock formations, is influenced by multiple factors, including the properties of the rock, the design characteristics of the RDEs, and the drilling operational parameters.
Hardness often measured using the Mohs scale or Vickers hardness (Hv), determines the resistance of the rock to penetration and cutting, directly affecting the mechanical stress on the RDE.
Anisotropy, arising from layered or fractured rock structures, introduces directional variations in mechanical properties, leading to uneven wear patterns.
These models adjust analytical equations with empirically derived correction factors.

In semiconductor packaging, conventional test procedures for evaluating mechanical properties of ball bonded gold wire bonding are well established.
To obtain mechanical properties, ball-bonded was cross-sectioned diagonally before indented at various locations.
This indicates test location plays important role in determining ‘meaningful’ mechanical properties.
Four areas or location represent nature aspect of ball bond physical and mechanical properties.
This shows that the location of the indentation must take into consideration in accessing mechanical properties of Au ball bond.

This alloy keeps good mechanical resistance but it exhibits poor surface properties.
The mechanical properties of the coatings were evaluated by microhardness, and adhesion tests.
Al4C3 formation has been avoided, the mechanical properties have been improved and the reaction mechanisms are proposed.
The last measurements were made to investigate the changes of mechanical properties.
Lu, et al., Effects of silicon on microstructure, fluidity, mechanical properties, and fracture behaviour of Mg – 6Al alloy Effects of silicon on microstructure, Fluidity, mechanical properties, and fracture behaviour of Mg ± 6Al alloy, Mater Sci Technol, 17 (2013), pp. 204-214, 10.1179/026708301101509872 [21] N.

The research findings indicate that incorporating a laminate layer into the hybrid composite positively affects its mechanical properties.
E-glass fiber, derived from glass, possesses robust mechanical properties and exhibits corrosion resistance.
The tensile test findings indicate that adding laminate layers into the hybrid composite positively affects its tensile properties.
Hybrid jute/glass reinforced laminate mechanical properties.
Effects of Laminate Layering on Mechanical Properties of Hybrid Composites.

Introduction Microchannel is an important functional structure in the micro-electro-mechanical system(MEMS).
And key properties of the deposition process inside microchannels has been studied, including shadowing effect, corner effect[5], step coverage[6], and key hole generation[4].
(a) (b) Fig.3 Variation of side-opening filling factors with different opening widths in the three channels (a) the first deposition (b) the second deposition.
As shown in Fig.3(a), the side-opening filling factors of the triangle and straight channels increase with the initial widths.
It indicated that all the filling factors increased with the widths of the channels.

This study examines the influence of contact factors such as bearing deformation, contact width and contact pressure on cage slide in cylindrical roller bearings.
Some researchers investigated the influence of various factors on the cage slide of radially loaded cylindrical bearing elements.
Factors such as operating speed, oil viscosity, radial clearance, and bearing load were shown to influence cage sliding, as described by bones [11].
Nallusamy and R.Maguteeswaran, Microstructural analysis and experimental investigation of mechanical properties of epoxy based hybrid composite reinforced with flax, sisal and luffa fibre, Journal of ceramic processing research, 23 (2022) 498-502
Gopal, Influence of AlCoCrCuFe High Entropy Alloy particles on the microstructural, mechanical and tribological properties of copper surface composite made through friction stir processing, Proceedings of the Institution of Mechanical Engineers, Part C: Journal of Mechanical Engineering Science, 235 (2021) 5555-5566

Tracking Error Transform in Parallel Kinematic Machining Ghasem Amirian1, a , Christian Schenck 2, b, Bernd Kuhfuss3, c 1 Department of Mechanical Engineering, Yazd University, Yazd, P.O.BOX 89195 -741, IRAN 2,3 bime, Bremen Institute for Mechanical Engineering and Production Systems, Badgasteiner Str. 1, 28359 Bremen, Germany a gamirian@yazduni.ac.ir, bschenck@bime.de, ckuhfuss@ bime.de Keywords: parallel kinematic machining, contour error, tracking error, velocity gain factor Abstract.
These tracking errors are a significant factor that affects machining accuracy, beside geometric machine errors, vibrations, temperature changes and tool errors.
Contour errors originate as tracking errors in joint space are transformed by the forward kinematics and affect the tool centre point path in global coordinates.
Fig. 1: Simplified model of a cascade controller Radial Deviations in CKM and PKM Tracing a circle is a well established and easily applicable test to characterize static and dynamic properties of machine tools for inspection and acceptance purposes.
Conclusion Enhanced accuracy in parallel kinematic machining requires high performances of both the mechanical parts, especially in the joints with multiple degrees of freedom, and the machine controller.

The quality of castings is also affected by other factors such as a die casting machine, a type of cast alloy and its metallurgical processing, the quality itself of the produced mold, the set technological parameters, and last but not least, attendance of die casting machine.
A selection of a correct speed of a die cavity filling depends on such factors as an alloy type, a casting complexity, a ratio of a slot area to a casting area, etc.[1, 4] Casting thermal factors - the basic casting thermal factors include: cast alloy temperature, pressure casting chamber temperature and mold temperature.[1] Temperature of a cast alloy - thecasting of very warm alloys into the cold a mold cavity causes serious strain on the surface layers of mold material.
Monitored was influence of three factors upon the stage of inhomogeneity of casting made of silumin the chemical composition of which is presented in table 1.
Out of the three mentioned intervals the castings cast at speed of 1 m.s-1 achieve the highest values Rm.Concerning the casting temperature the top quality castings were obtained at the alloy temperature of 660°C with left bars and with right bars at the alloy temperature of 640°C. [4] Conclusion Plunger pressing speed during the casting cycle and its dependent speed of a mold cavity filling with the liquid metal is an essential technological factor of die casting which affects mechanical properties of the die castings and determines the mode of a mold cavity filling affecting the casting homogeneity.
References [1] Gaspar, S. - Pasko, J.: Influence of technological factors of die casting on mechanical properties of castings from silumin, Lecture Notes in Electrical Engineering, Vol. 240, 2013, p. 713-722 [2] Gaspar, S. - Pasko, J.: Metal flow velocity in an intake port in the process of die casting, Advanced Materials research, Vol. 705, 2013, p. 177-180 [3] Pasko, J. - Gaspar, S.: Homogeneity and the height of the metal rest inside a filling chamber of die casting machine, Advanced Materials Research, Vol. 746, 2013, p. 457-461 [4] Malik, J. - Gaspar, J - Pasko, J.: Effect of die casting technological factors on the mechanical properties of castings, Manufacturing Engineering, Vol. 8, 2009, p. 32-37 [5] Ruzbarsky, J. - Zarnovsky, J.: Optimatization of parameters in the compression moulding process of thermoset products,Advanced Materials Research, Vol. 801, 2013, p. 61-66 [6] Novak - Marcincin, J.