Search results

%d 1 gi|917845999 hypothetical protein Sulfolobus islandicus 163129/5.77 97.43 2 gi|332694348 conserved hypothetical protein Acidianus hospitalis 48665.4/7.03 97.59 3 gi|503541050 D-galactarate dehydratase Acidianus hospitalis 42119.9/5.4 100 4 gi|503541050 D-galactarate dehydratase Acidianus hospitalis 42119.9/5.4 100 5 gi|612167172 glutaredoxin Acidianus copahuensis 25841.9/4.66 99.99 6 gi|332694619 superoxide dismutase Acidianus hospitalis 24296.3/6.71 100 7 gi|332694619 superoxide dismutase Acidianus hospitalis 24296.3/6.71 100 8 gi|612170351 superoxide dismutase Acidianus copahuensis 24164.1/6.44 100 9 gi|332694619 superoxide dismutase Acidianus hospitalis 24296.3/6.71 100 10 gi|503541427 ATPase Acidianus hospitalis 36612/8.57 76.55 11 gi|612170409 sulfur reduction protein DsrE Acidianus copahuensis 15340.4/4.72 100 12 gi|612170409 sulfur reduction protein DsrE Acidianus copahuensis 15340.4/4.72 100 13 gi|756978656 ATPase Desulfurococcus amylolyticus 68444/8.46 88.62 14 gi|332694027
/˚C Amplicon length /bp 1 B6F84_04620 Hypothetical protein F: CTCCTTTCAGCAGGGAAAAA R: AGAGGCCTTAGCATATGGAGAA 52 204 3 B6F84_06985 Hypothetical protein F: GAAGCTCGAAAGGTCGGAAT R: TGCAGGAGCAGTTGCATTAG 52 134 5 B6F84_08030 Glutaredoxin F: TTGGTAGCCTATGAAGCGTGT R: GGCACTGGCTATTACTTGATACTT 52 111 6 B6F84_09650 Phosphoribosylformyl- glycinamidine synthase II F: GCAGCAGTTGGTGTGGTAAA R: GCACCAATTTCGTCTTCTCC 52 155 10 B6F84_06265 Replication factor C large subunit F: AAGCAAAGAATGCCGTGACT R: TTGCTACTCCTGGACCCATT 52 213 11 B6F84_12565 Sulfur reduction protein DsrE F: TGTGGCACATATCCTTTAGGC R: GGCTTCAATATCGGCTTCAA 52 197 17 B6F84_03615 Serine protease F: AGCTAGATTGCTGGCCTGTC R: ATCGGGAGCTAAAGGAGCTG 52 176 18 B6F84_04980 Gluconolaconase F:CAGTTTCTAATGGTTTAGGATGGAA R: CGGTCATTCCGTCAGGATTA 52 171 26 B6F84_05265 Aldehyde oxidase F: AGATTGAGACTAGAAAAGAGCATC R: TGAGCTAGCAATAAATGCAGGA 52 173 Reference genes gi|145688429 16S rRNA F: AGAGGGCTTTTCCCTACTGC R: GCCCCTACTCTGGGAGTACC 52 232 Note: (a) IDs
B6F84_08030, B6F84_12565 and B6F84_04980) encoding glutaredoxin, sulfur reduction protein DsrE and gluconolaconase were also found in other species (Tables 2-3), indicating that these genes might have significant role during activation/biooxidation of S0.
RT-qPCR expression data for selected genes A. manzaensis.

The tensile properties were tested in the universal tensile tester with the special tooling chuck at the stretching rate of 0.5mm/min, and each tensile test data were tested in three times.
The variation of ultimate tensile strength (UTS), yield strength (YS) and elongation, reduction of area are shown in Fig. 5(b) and (c).
In the upper rim, the values of UTS, YS and elongation, reduction of area are equal to 282.4MPa, 185.1MPa and 14.3%, 5.6%, respectively, indicating the best mechanical properties.
After hot spinning, the elongation and area reduction of the rim are as high as 18.9% and 19.7%.
The tensile strength and yield strength of the lower rim are slightly lower than the upper rim, but its elongation and reduction of area are slightly improved.

Under the increased experimental power, it is much easy for the reduction of the silver ions to silver nanoparticles, then to reach on the surfaces of silica spheres.
The morphologies of the silver nanoparticles were related to the reduction rate of the silver ions.
Slow reduction rate resulted in uneven shapes[8].
With the silver ion concentration increased, as shown in Fig. 2B, more uniform Ag shells were formed due to the increased reduction rate of silver ions.
As can be seen from the data, no distinct peaks were observed for bare silica owing to the strong scattering from the silica colloid (Fig. 4a) [9].

The nondestructive tester is composed of pulse/receiver device, oscilloscope and computer for the exact measurement and the data analysis of ultrasonic wave.
The MoSi2 material represented a longitudinal wave velocity of about 6900 m/s at the thermal shock of 80 cycles after its rapid reduction beyond the thermal shock of 60 cycles (373 K).
The increase of thermal shock temperature also decreased the number of repeated cycle for a great reduction of material strength
(3) The velocity of longitudinal wave for MoSi2 materials greatly decreased due to the thermal aging after the steady reduction at the beginning of the thermal shock cycle, regardless of thermal shock temperatures.
The MoSi2 material represented the drastic reduction of longitudinal wave velocity at the thermal shock of 40 cycles under the temperature of 423 K

The reduction of variable greatly reduces the difficulty of programming and shortens the calculating time.
As mentioned before, the most prominent advantages of the algorithm were reduction of variables in the Hough transform and algorithm simplification in feature points detection.
The reduction of computing time is good for real-time welding and the error which is caused by the time delay of robot arm movement.
Moreover, the less memory cost results in the production cost reduction that makes it capable for industrial application.
The application of modified Hough algorithm was also conductive to the later algorithms design since it helps decreasing the calculation data in the later steps from millions to at most hundreds.

The first consideration to be highlighted from the data of Fig. 1 is that the application of a PVD coating on a 7075-T6 substrate in a high applied stresses region of the S-N curve (i.e.
When considering the effects of the aggressive environment, the most evident result is a strong reduction of the fatigue life of the uncoated 7075-T6 material in methanol: the limiting stress is 199 MPa for the rougher specimens and 195 MPa for the diamond polished samples.
From the testing and the SEM investigation, it can be concluded that: · A certain reduction of the fatigue strength at 2∙105 is found in air, caused by the coating process, especially for the diamond polished specimens (-15% on the limiting stress)
· A dramatic reduction of the limiting stress is found in the uncoated specimens exposed to methanol, in terms of -16% for the 1200 grit paper surface finishing and -29% for the diamond polished specimen.
· The beneficial effects of the DLC layer in aggressive environment disappear for a 1200 grit paper treated surface, showing a -20 % drop in fatigue strength from the DLC coated specimen in air, comparable to the reduction experienced by the uncoated specimens in methanol (-16%).

However, the improvement of I-V characteristics and reduction of the on-resistance, Ron, was found necessary.
It is clearly demonstrated that the Schottky contact is effectively shielded by the high barrier introduced by the buried p-type regions, which results in the reduction of the electric field and reduced Schottky barrier lowering [5].
The reduction of the maximum blocking voltage between 25 oC and 350 oC reaches 300 V when the channel layer thickness is increased to 2.3 µm.
As shown in Fig. 8, the reduction of the maximum blocking voltage between 25 oC and 350 oC is approximately 800 V when the p-grid doping is 1.2×1017 cm-3.
The measurement data from a set of experimental samples with low p+ grid doping are also shown.

General situation of Zhenshui Xiaolangdi Reservoir is a comprehensive utilization project and its development mission was definitely oriented to flood control (including ice prevention) and sedimentation reduction, and balanced water supply, irrigation and hydropower generation.
Field observation data show that: there is little incoming water and sediment in Zhenshui, and basically there is no sediment.
When water level declines, if water level difference is not enough to influence the stability of sand bar or the sand bar is not completely broken, then the isolated water body will come into being, the storage capacity of tributary will not be effectively used, and the efficiency of sedimentation reduction and even flood control will be affected.
According to present research requirement, based on terrain formed by the test of operational mode one of Xiaolangdi Reservoir for flood control and sedimentation reduction during later sediment retaining period [3], the sand bar at estuary of Zhenshui is modified little and then is adopted as the initial terrain of this test.
P., and Wang Y.: Report on model test of the first operational mode of Xiaolangdi Reservoir for flood control and sedimentation reduction during later sediment retaining period (Yellow River Institute of Hydraulic Research, YRCC, China 2010, In Chinese ).

However, such diameter reduction could not account for the increase in specific surface area of the activated materials, which has to be attributed to porosity development.
Rouquerol et al., Reporting physisorption data for gas solid systems with special reference to the determination of surface-area and porosity (recommendations 1984), Pure Appl.
Olivier, Improving the models used for calculating the size distribution of micropore volume of activated carbons from adsorption data, Carbon 36 (1998) 1469-1472. ].
Structural parameters of the fresh and different activated CNF samples as deduced from XRD data.
Likewise, an appreciable reduction in nanofiber diameter following both types of activation was noticed.

In order to improve the common defects of uneven cell size and cell rupture in MuCell, this study aims to ameliorate the issues of excessively large open-cell structure and density reduction caused by cell rupture in MuCell with thermoplastic polyurethane (TPU).
Positions for taking SEM images Cell density was determined by importing the captured SEM images into AutoCAD to carry out data extractions and diameter measurements, and then perform the calculations based on the following equation [13]： (2) where is the cell density (cell/cm3), is the number of cells in the micrograph, is the area of the micrograph (cm2 ), and is the magnification of the micrograph.
Experimental procedures This study aims at discussing how to improve the cell structures of the TPU under the requirement of a high weight reduction.
All weight reductions were set to 55 %.
Comparison of the cell density Conclusions Due to the low viscosity of the TPU melt in the MuCell® process, it is likely to produce large cells or even cause cell rupture under the requirements of high expansion ratio and high weight reduction.