Search results

Coutelieris Department of Engineering and Management of Energy Resources, University of Western Macedonia, Bakola & Sialvera, 50100 Kozani, Greece, Tel: +302461056751; Fax: +302461021731 and National Center for Scientific Research "Demokritos", 15310 Aghia Paraskevi Attikis, Greece, Tel: +302106503447; Fax: +302106525004 fcoutelieris@uowm.gr; frank@ipta.demokritos.gr Keywords: SOFC, anode; catalyst layer; heat transfer; mass transport.
Introduction During the last years, fuel cells have attracted considerable scientific and engineering interest because they present high efficiency and very low environmental impact.
The mass transport within a fuel cell is a key factor to its performance.
In particular, anode is divided into three regions: an electrolyte region, an active catalyst region (catalyst layer) that provides a catalytic site for the oxidation of fuel and a diffusion region (diffusion layer) composed of highly porous and electronically conductive material.
By taking into account the material balance for the water, its mass flux is given as 4 d w w I i j j F − = + (4) where 4 I i F − is the flux of the produced water mass and dwj represents the water flux entering the catalyst through the diffusion layer.

Materials and Methods Samples were obtained from rhesus macaques trapped in 8 localities (Heishui, Xiaojin, Bazhong, Jiulong, Hanyuan, Beichuan, Pingwu and Danba) of Sichuan province (Fig1).
We used Primer Premier 5.0 software and the complete mitochondrial DNA sequence （AY612638）of Macaca mulatta [15] to design the following pair of primers to amplify an approximately 500bp control region fragment near the Cytochrome b gene: Upper primer: 5' TAGGGCAATCAGAAAGGAAGTACC 3', Lower Primer: 5' GCCTTGAGGTAAGAACCAGATGC 3' (synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.).
PCR products were purified with an EZ Spin Column DNA Gel Extraction Kit (Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.) and direct sequencing was conducted on an ABI PRISM 3730 automated sequencer (Applied Biosystems).
*This work was supported by the Program for Changjiang Scholars and Innovative Research Team in University (IRT0848); Key laboratory of Animal Disease and Human Health of Sichuan Province (SZDSYS-200601), Natural Science Foundation of Educational Commission of Sichuan Province of China (08ZA076).

Experimental studies on the isothermal and heat transfer performance of trough solar power collectors Yun Liu1,a, Hong Zhang2,b 1Department of Power Engineering, North China Electric Power University, Baoding 071003, China 2School of Energy, Nanjing University of Technology, Nanjing 210009, China aliuyunlucia@ncepu.edu.cn bhzhang@njtu.edu.cn KEY WORDS: medium temperature heat pipe; parabolic trough thermal generating system; solar energy receiver; half circle heated; isothermal performance; heat transfer performance ABSTRACT: The medium temperature heat pipe is a highly effective heat transfer element through heat exchange due to phase-change of the liquid organic working fluid.
The inlet and outlet of the tube were filled with heat insulating materials to prevent the loss of heat.
Journal of Solar Energy Engineering. 2002，5 (124): 140~144 [4] Ivàn Martínez, Rafael Almanza.

The media materials are usually optics fiber and copper-wires.
In tabu search, there are five key concepts to guarantee the performance of optimization, which are neighborhood, tabu list, tabu length, candidate and aspiration criterion.
Liu, „Research and implementation of on-line monitoring techniques for high voltage equipments in Smart Grid,“ High Voltage Engineering and Application (ICHVE), 2010 International Conference on, pp. 236-239, 11-14 Oct 2010
Hyun, "Optimal placement of phasor measurement units with GPS receiver," Power Engineering Society Winter Meeting, 2001.

Phosphine-free Synthesis and Photoluminescence Properties of ZnSe:Cu/ZnSe/ZnS Core/shell Nanocrystals Jinzhong Niu1, a, Guimin Tian1, Lili Zheng1, Yongguang Cheng1, Shuangmei Zhu1, and Haoshan Hao1,b 1Department of Mathematical and Physical Sciences, Henan Institute of Engineering, Zhengzhou, 451191, P.
It is well known that TOP and TBP are hazardous, unstable, and expensive materials and generally require glove box operations.
Acknowledgements This work was supported by the Natural Science Research Program of Henan Educational Committee, China (12A430003, 12A140002), and the Key Science and Technology Program of Henan Province, China (Grant No.112102310543), Youth Fund of Henan Institute of Engineering, China (Y2010020).

Bartelmus, Gearbox condition estimation using cyclo-stationary properties of vibration signal, Key Engineering Materials 413-414 (2009) 471-478
Zimroz, Application of Spectral Correlation Techniques on Mining Machines Signals: Extraction of Fault Signatures, 2nd World Congress on Engineering Asset Manag. and the 4th Int.

Lad3, b and Arun Pratap3,c 1 Dept. of Electronics, Mukesh Patel School of Technology Management & Engineering, SVKM’s NMIMS deemed University, Vile Parle West, Mumbai – 400 056, India 2 Electronics Department, Narmada College of Science & Commerce, Zadeshwar, Bharuch – 392011, India 3 Condensed Matter Physics Laboratory, Applied Physics Department, Faculty of Technology and Engineering, The M.
University of Baroda, Vadodara – 390 001, India a heena0609@yahoo.co.in, b kiritlad@yahoo.com, c apratapmsu@yahoo.com Key words: crystallization, isoconversional, activation energy, metallic glasses.
Experimental Specimens of amorphous Ti50Cu20Ni30 ribbons were prepared by single roller melt spinning technique in an Argon atmosphere at the Institute of Materials Research, Tohoku University, Sendai, Japan.

Roads are the key infrastructure that is needed to support the smooth transportation to improve the condition of the community economy.
Various methods and schemes are used for priority analysis ranging from simple lists based on engineering assessments to correct optimization based on mathematical formulations.
Getahun, Analysis on Road Safety Inspection using Analytical Hierarchy Process (AHP) Method A case study in Addis Ababa city, Thesis of the School of Civil and Environmental Engineering, Addis Ababa University, Ethiopia, 2017
Rani, Development priority of Road Infrastructure the Aceh post tsunami in Simeulue District, International Journal of Civil Engineering. 6:3 (2017) 9-17
Series: Materials Science and Engineering. 615 (2019) 012106

Modern engineering technology exhibition.
Ye Sanguan has the unique geographical environment and all kinds of project started the different areas of the world leading technology in the surroundings The highest bridge in the world, the most beautiful grand in the world-canyon railway station, the world first face rock-fill dam in the collection, it can be called the modern engineering technology application museum.
Agricultural ecological environment is good, the mountain vegetables, the middle mountain medicinal materials, the low mountain animal husbandry, forming modern agriculture ecology natural.
Here referring to zero pollution, including traffic construction, housing construction, energy using and so on, they are all the pollution-free raw materials, it really becomes an ecological tourist area.
Advanced Materials Research,2011.

Energy transfer phenomena have led to the development of new and efficient photoluminescence materials.
Thus, single crystals of yttrium aluminum borate (YAl3(BO3)4, YAB) possess good physical and chemical characteristics and therefore it belongs to unique multi-functional materials with device potential to be used in the fields of nonlinear optics and laser engineering.
The starting materials were Y2O3, Al2O3, H3BO3, Y2O3, Ce2O3, Dy2O3, Tb2O3.
The stoichiometric raw materials were weighed out and ground thoroughly in an agate mortal pestle for 15 minutes in acetone.
Grabmaier, Luminescent Materials, Springer-Verlag, Berlin, 1994